View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_64 (Length: 220)
Name: NF16931_low_64
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_64 |
 | |
|
| [»] scaffold0182 (1 HSPs) |
| | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0182 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 29035 - 28850
Alignment:
| Q |
18 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaaaagaaaatttcttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29035 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaagagaaaatttcttgc |
28936 |
T |
|
| Q |
118 |
atatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28935 |
atatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
28850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 276145 - 275960
Alignment:
| Q |
18 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaaaagaaaatttcttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
276145 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaagagaaaatttcttgc |
276046 |
T |
|
| Q |
118 |
atatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276045 |
atatgttgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
275960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 26396750 - 26396565
Alignment:
| Q |
18 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaaaagaaaatttcttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26396750 |
gaatgaagatagtcagctcacctcttttacaatattcgactttggaaatagggaagaatttgttgtagagtgggatgcatcgaaagagaaaatttcttgc |
26396651 |
T |
|
| Q |
118 |
atatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26396650 |
atatgttgtttgtttgagtataatgggtatctttgtagacattcattgatggccctccaatatagtggtatctttgctgtcccatc |
26396565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 70 - 168
Target Start/End: Complemental strand, 19219213 - 19219115
Alignment:
| Q |
70 |
gaagaatttgttgtagagtgggatgcatcgaaaaagaaaatttcttgcatatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatg |
168 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||| | || |||||| ||| ||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
19219213 |
gaagagtttgttgtagagtgggatgcatcaaaagctgaaatatattatttatgtcatttatttgagtttaatggatatcttagtagacattcattgatg |
19219115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 98
Target Start/End: Complemental strand, 19217023 - 19216995
Alignment:
| Q |
70 |
gaagaatttgttgtagagtgggatgcatc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19217023 |
gaagaatttgttgtagagtgggatgcatc |
19216995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 80 - 170
Target Start/End: Original strand, 56109351 - 56109441
Alignment:
| Q |
80 |
ttgtagagtgggatgcatcgaaaaagaaaatttcttgcatatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggc |
170 |
Q |
| |
|
|||||||||| |||| ||||| ||| |||| || || ||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56109351 |
ttgtagagtgtgatgtctcgaagaaggaaatatcgtgtctatgtcgcttttttgagtataatgggtatctttgtagacattcattgatggc |
56109441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 26015156 - 26015207
Alignment:
| Q |
119 |
tatgtcgtttgtttgagtataatgggtatctttgtagacattcattgatggc |
170 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26015156 |
tatgtcgcttttttgagtataatgggtatctttgtagacattcattgatggc |
26015207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University