View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16932_high_4 (Length: 250)
Name: NF16932_high_4
Description: NF16932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16932_high_4 |
 |  |
|
| [»] scaffold0135 (7 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 235
Target Start/End: Original strand, 35902676 - 35902786
Alignment:
| Q |
125 |
tttagttttaattagattctttatctaatttttagtttcagtttggtcat-atatagtctcattttatattcagtttcgtcttaatgatcctttatattt |
223 |
Q |
| |
|
|||||||||| |||| |||||||||| | ||||| |||||||||||||| ||||||||||||||| |||||| ||| ||| |||||||||||||| ||| |
|
|
| T |
35902676 |
tttagttttagttaggttctttatcttacttttaaattcagtttggtcataatatagtctcattttttattca-tttagtcctaatgatcctttattttt |
35902774 |
T |
 |
| Q |
224 |
tttaaattgttc |
235 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
35902775 |
ttcaaattgttc |
35902786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 23892461 - 23892583
Alignment:
| Q |
125 |
tttagttttaattagattctttatctaatttttagtttcagtttggtcata-tatagtctcattttatattcagtttcgtcttaatgatcctttatattt |
223 |
Q |
| |
|
|||||||||| || | || ||||||| ||||||| | ||||||| ||||| ||| ||||||||||||||||| ||| ||| |||||| ||||||| ||| |
|
|
| T |
23892461 |
tttagttttagtttggttatttatcttatttttaaatccagtttgctcataatattgtctcattttatattcaatttagtcctaatgaccctttattttt |
23892560 |
T |
 |
| Q |
224 |
tttaaattgttcctttgcttcta |
246 |
Q |
| |
|
|| ||||||||| || ||||||| |
|
|
| T |
23892561 |
ttcaaattgttctttcgcttcta |
23892583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 9203977 - 9204007
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9203977 |
ctcacaaagttgtttagcattgtgtttgatg |
9204007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 9208196 - 9208226
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9208196 |
ctcacaaagttgtttagcattgtgtttgatg |
9208226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135 (Bit Score: 31; Significance: 0.00000002; HSPs: 7)
Name: scaffold0135
Description:
Target: scaffold0135; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 2060 - 2090
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2060 |
ctcacaaagttgtttagcattgtgtttgatg |
2090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 6275 - 6305
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6275 |
ctcacaaagttgtttagcattgtgtttgatg |
6305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 10490 - 10520
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10490 |
ctcacaaagttgtttagcattgtgtttgatg |
10520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 14705 - 14735
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14705 |
ctcacaaagttgtttagcattgtgtttgatg |
14735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 18920 - 18950
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18920 |
ctcacaaagttgtttagcattgtgtttgatg |
18950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 23135 - 23165
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23135 |
ctcacaaagttgtttagcattgtgtttgatg |
23165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 27350 - 27380
Alignment:
| Q |
1 |
ctcacaaagttgtttagcattgtgtttgatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27350 |
ctcacaaagttgtttagcattgtgtttgatg |
27380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University