View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16932_low_3 (Length: 282)
Name: NF16932_low_3
Description: NF16932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16932_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 28935822 - 28935967
Alignment:
| Q |
8 |
tgatatgaaagttttgaaggtataagttctcattatatactactatgtttttaagctttctcggattttttcactgaaatttagattttactgttattct |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28935822 |
tgatatgaaagtt--gaaggtataagttctcattatatactactatgtttttaagctttctcggattttttcactgaaatttagattttgctgttattct |
28935919 |
T |
|
| Q |
108 |
tgtaacaaaaataacattttgttattgttgacataaagtaacaaaaca |
155 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28935920 |
tgtaacaaaaataacattttgttattgtcgacataaagtaacaaaaca |
28935967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 183 - 264
Target Start/End: Original strand, 28935998 - 28936080
Alignment:
| Q |
183 |
ttcattactcccttggttgatcttcgaataatctttttaaccgtgtgatgctgaatgttgtg-tttttattcaccgtcgtttt |
264 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28935998 |
ttcattactccctcggttgatcttcgaataatctttttaaccgtgtgatgctgaatgttgtgttttttattcaccgtcgtttt |
28936080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University