View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16932_low_7 (Length: 224)
Name: NF16932_low_7
Description: NF16932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16932_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 7723194 - 7723011
Alignment:
| Q |
11 |
tgagatgaacgatgcatcattctttgtgaaaaagagtaatggaaaatgaatgatttgaagggnnnnnnnagagtagagtagagtagagaagagtgaattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
7723194 |
tgagatgaacgatgcatcattctttgtgaaaaagagtaatggaaaatgaatgatttgaaggg----------gttttttagagtagagaagagtgaattg |
7723105 |
T |
 |
| Q |
111 |
ttgtcttgtagtgtttgaagataataaaatgtcgaaatactagtcagcacctgcagtccacgttgtcgtgaattgcaaatggagacatgtacat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723104 |
ttgtcttgtagtgtttgaagataataaaatgtcgaaatactagtcagcacctgcagtccacgttgtcgtgaattgcaaatggagacatgtacat |
7723011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University