View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16933_high_40 (Length: 227)
Name: NF16933_high_40
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16933_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 45981802 - 45981593
Alignment:
| Q |
1 |
gatgatgtggttgctgctgctattaaaatttcaattaattattaataagttgatggattatgttaccattttctagattatttatgtagggcagtttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45981802 |
gatgatgtggttgctgctgctattaaaatttcaattaattattaataagttgatggattatgttactattttctagattatttatgtagggcagtttcaa |
45981703 |
T |
 |
| Q |
101 |
atcttagctgtgctatttgaagtgcagtataaaacatcctctattgttcttttttccattattataaatgaaatgaaatgaaatgaattttatagtattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45981702 |
atcttagctgtgctatttgaagtgcagtattaaacatcctctattgttcttttttccattattataaatgaaatgaaa-----tgaattttatagtattt |
45981608 |
T |
 |
| Q |
201 |
attgttcctttgctt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45981607 |
attgttcctttgctt |
45981593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University