View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16933_low_14 (Length: 389)
Name: NF16933_low_14
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16933_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 28 - 389
Target Start/End: Original strand, 44969008 - 44969366
Alignment:
| Q |
28 |
caaaatcctccatttatttctcttctaaactcccaaacaaaacttacaggtaaaatatagttttattacttacaaagtgagatcatatgaaattagtttc |
127 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44969008 |
caaaatcctccatttatttttcttttaaactcccaaacaaaacttataggtaaaatatacttttattacttacaaagtgagatcatatgaaattagtttc |
44969107 |
T |
 |
| Q |
128 |
tatcaattttttatttgagttttagtcccccgcatctttgttgttcgaaatattattttttgttgctaaattttgaatagaataatgttttatgaacacc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
44969108 |
tatcaattttttatttgagttttagtcccccacatctttgctgttcgaaatattattttttgttgccaaattttaaatagaataatgttttatgaacacc |
44969207 |
T |
 |
| Q |
228 |
annnnnnnnncccatacccctattatacatccaatgcgacactagggacatttttgtatttgtttttgaaattacatatgttttgatctccattggccaa |
327 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44969208 |
a--tttttttcccatacccctattatacatccaatgcgacactagggacatttttatatttgtttttgaaattacatatgttttgatctccattggccaa |
44969305 |
T |
 |
| Q |
328 |
atatccgttctttttctcttcttgattcaataaccaatacataggacaattgaggggaactc |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44969306 |
atatccgttctttttctcttcttgattcaataaccaatacataggacaa-tgaggggaactc |
44969366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University