View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16933_low_33 (Length: 252)

Name: NF16933_low_33
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16933_low_33
NF16933_low_33
[»] chr3 (1 HSPs)
chr3 (26-172)||(52027964-52028110)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 26 - 172
Target Start/End: Complemental strand, 52028110 - 52027964
Alignment:
26 tatttaatattttgattgcaataaataatttgatttctatttacaaacaaaatccctaactagaaattatttgaccgtaggtacaaccataaatgtgcct 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52028110 tatttaatattttgattgcaataaataatttgatttctatttacaaacaaaatccctaactagaaattatttgaccgtaggtacaaccataaatgtgcct 52028011  T
126 ctaactttcactattgacccagacgaggcgtcaattatgtatgtcgt 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
52028010 ctaactttcactattgacccagacgaggcgtcaattatgtatgtcgt 52027964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University