View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16933_low_34 (Length: 251)
Name: NF16933_low_34
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16933_low_34 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 3723 - 3962
Alignment:
| Q |
13 |
aaggaacaatctgcatatataaatgaaaataacaatgatactgagtaaataaacaagatgcatgctagccacatacatcaaa-gggggcagcaacaacag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3723 |
aaggaacaatctgcatatataaatgaaaataacaatgatactgggtaaataaacaagttgcatgctagccacatacatcaaaagggggcagcaacaacag |
3822 |
T |
 |
| Q |
112 |
tagagagtagatagagtatagttatagtgaaagtggagaggccaagatctttgagaggaatgacatattggagcatgagcagcgcgtaaaagcaccatcc |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823 |
tagagagtagatagagtatagttgtagtgaaagtggagaggccaagatctttgagaggaatgacatattggagcatgagcagcgcgtaaaagcaccatcc |
3922 |
T |
 |
| Q |
212 |
aaagaaaaatagaaaatcacatatcaaagttatcgcgcgg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3923 |
aaagaaaaatagaaaatcacatatcaaagttatggcgcgg |
3962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University