View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16933_low_36 (Length: 248)
Name: NF16933_low_36
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16933_low_36 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 227934 - 227699
Alignment:
| Q |
1 |
ttaaactcatggatactgacactgagattagtcctcaggttaatcggtccttggatcggataccgagtttttatnnnnnnnnnnnnnnnnnnctaataga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
227934 |
ttaaactcatggatactgacactgagattagtcctcagattaatcggtctttggatcggataccgagtttttataaaaacaaacacaaaaaacttataga |
227835 |
T |
 |
| Q |
101 |
cacttcttttcaccaaggtgaacgtgaatttcacaacgaactcttcttcgcttcaaagcttcgttctctttacacaattccaccgttagggttttcatct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
227834 |
cacttcatttcaccaaggtgaacgtgaatttcacaacgaactcttcttcgcttcaaagcttcgttctctttacacaattccaccgttagggttttcatct |
227735 |
T |
 |
| Q |
201 |
gacccaaaacgacgtcgttttttacttgtttatcct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
227734 |
gacccaaaacgacgtcgttttttacttgtttatcct |
227699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 70
Target Start/End: Original strand, 12710336 - 12710373
Alignment:
| Q |
33 |
cctcaggttaatcggtccttggatcggataccgagttt |
70 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12710336 |
cctcagattaatcggtccttggatcggataccgagttt |
12710373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 70
Target Start/End: Original strand, 15115692 - 15115720
Alignment:
| Q |
42 |
aatcggtccttggatcggataccgagttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15115692 |
aatcggtccttggatcggataccgagttt |
15115720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 71
Target Start/End: Complemental strand, 28194174 - 28194138
Alignment:
| Q |
35 |
tcaggttaatcggtccttggatcggataccgagtttt |
71 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
28194174 |
tcagattagtcggtccttggatcggataccgagtttt |
28194138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 72
Target Start/End: Original strand, 1486590 - 1486618
Alignment:
| Q |
44 |
tcggtccttggatcggataccgagttttt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1486590 |
tcggtccttggatcggataccgagttttt |
1486618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University