View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16933_low_46 (Length: 216)
Name: NF16933_low_46
Description: NF16933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16933_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 14433278 - 14433095
Alignment:
| Q |
16 |
tgaaatcatgggagaactaagatagatttgccaaacctaggagataacaagtttgctttctacaaagcatttatagaaatgagaaaactcttttacttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433278 |
tgaaatcatgggagaactaagatagatttgccaaacctaggagataacgagtttgatttctacaaagcatttatagaaatgagaaaactcttttacttca |
14433179 |
T |
 |
| Q |
116 |
cccatgaaatacttcccatttttgatgaacttgtaaagagactatggactcatggtagatctaataacaaacaagtgttgagtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433178 |
cccatgaaatacttcccatttttgatgaacttgtaaagagactatggcctcatggtagatctaataacaaacaagtgttgagtt |
14433095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University