View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16934_low_4 (Length: 282)
Name: NF16934_low_4
Description: NF16934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16934_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 33675754 - 33676005
Alignment:
| Q |
19 |
tcacctcctattcatacattctgctgctgtttctttatggaattttgaggataattctaccagcccttgtttattaaacaaagtacgtttaaaagaggca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675754 |
tcacctcctattcatacattctgctgctgtttctttatggaattttgaggataattctaccagcccttgtttattaaacaaagtacgtttaaaagaggca |
33675853 |
T |
 |
| Q |
119 |
ccactatgattaggttatcggttatcacatgattgtttttccaaacacatgcaaatgcagactgtttaaaaaggaaacacttgagctgcttatcttatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33675854 |
ccactatgattaggttatcggttatcacatgattgtttttccaaacacatgcaaatgcagactcttt-aaaaggaaacacttgagctgcttatcttatta |
33675952 |
T |
 |
| Q |
219 |
gggtaacattgtttttcattagatggtcattcttaagatttgtaccagccttt |
271 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675953 |
ggataacattgtttttcattagatggtcattcttaagatttgtaccagccttt |
33676005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University