View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16935_high_19 (Length: 239)
Name: NF16935_high_19
Description: NF16935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16935_high_19 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 42419 - 42637
Alignment:
| Q |
3 |
caacttatagataaatgataaagccttttatatcctctaagtggaacttggatttttccgaatatttagattttttctaagataagtcttaatgcccggt |
102 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||| || |
|
|
| T |
42419 |
caacttatagataaatgataaaaccttttatatcctctaagtgaaacttggatttttccgaatatttaaattttttctaagagaagtcttaatgccctgt |
42518 |
T |
|
| Q |
103 |
ctttcctttgggttgcgcctgggattatgtgaagttaacatttacttgctagtcacgattcttcatgtactacataactggtcaaatttaacttcacagg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42519 |
ctttcctttgggttgcgcctgggattatgtgaagttaacatttacttgctagtcacgattcttcatgtactacatagctggtcaaatttaacttcacagg |
42618 |
T |
|
| Q |
203 |
gatgaatatgacagatgat |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42619 |
gatgaatatgacagatgat |
42637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University