View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16935_low_11 (Length: 308)
Name: NF16935_low_11
Description: NF16935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16935_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 11 - 293
Target Start/End: Original strand, 26492450 - 26492732
Alignment:
| Q |
11 |
cataggcagccatcatcgtaggaacccaaaagattgaaattgttaatcaaattaagtaattaatgaactaatattgcgtacgttcttaggtatagtgaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26492450 |
cataggcagccatcatcgtaggaacccaaaagattgaaattgttaatcaaattaagtaattaatgaactaatattgcgtacgttcttaggtatagtgaat |
26492549 |
T |
 |
| Q |
111 |
aattactatagtttattcataggatcatagaattagaacccctaggtttgacacttacactgaatttgatgcaaattcttcatttttatgagcatgattc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26492550 |
aattactatagtttattcataggatcatagaattagaacccctaggtttgacacttacactgaatttgatgcaaattcttcacttttatgagcatgattc |
26492649 |
T |
 |
| Q |
211 |
aaggctaaccgtaggattttcatgttttgattagtggacttcagctttgctaacacttactttgctcataataaataaatatt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26492650 |
aaggctaaccgtaggattttcatgttttgattagtggacttgagctttgctaacacttactttgctcataataactaaatatt |
26492732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University