View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16935_low_17 (Length: 241)

Name: NF16935_low_17
Description: NF16935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16935_low_17
NF16935_low_17
[»] chr2 (1 HSPs)
chr2 (1-142)||(7422863-7423003)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 7423003 - 7422863
Alignment:
1 ggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctacccttacgtaatgattgaatgatggtgacggtggtgatggcgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7423003 ggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctaccctt-cgtaatgattgaatgatggtgacggtggtgatggcgat 7422905  T
101 ggcgatggtgctagtgctgctaatattgccaatgtcgaagtc 142  Q
    || |||||||||||||||||||||||||||||||||||||||    
7422904 ggtgatggtgctagtgctgctaatattgccaatgtcgaagtc 7422863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University