View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16936_low_4 (Length: 309)
Name: NF16936_low_4
Description: NF16936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16936_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 14 - 183
Target Start/End: Original strand, 7682494 - 7682662
Alignment:
| Q |
14 |
aataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttgggtaattcgtctagatcctcctggtctgtagaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7682494 |
aataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttgggtaattcgtctagatcctcctggtctgta-aa |
7682592 |
T |
 |
| Q |
114 |
cactcttca---tatttgtttgctcagataaactttagatgattcttgataattttatcttttcggttatgtt |
183 |
Q |
| |
|
||| | | |||| |||||| ||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7682593 |
tcctcattaggtgatttttttgct---ataaactttaggtgatttttgataattttatcttttcggttatgtt |
7682662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University