View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16939_low_1 (Length: 447)
Name: NF16939_low_1
Description: NF16939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16939_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 27 - 428
Target Start/End: Original strand, 26496598 - 26496999
Alignment:
| Q |
27 |
gagggacacgtccgagctttagagagcctttcttgagggcacctttacctttaggaatgtagatggtctacaatctcccaagcacgagtcttagacaaga |
126 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
26496598 |
gagggacacgtccgagctttagcgagcctttcttgagggcacctgtgcctttaggaatgtagatggtccacaatctcccaaacacgagtcttaggcaaga |
26496697 |
T |
|
| Q |
127 |
tgaagtggtgagggcgtctgaacgagttgggttattttgaagattgctagggtgagtcgtttggtatatgatcagacgacttagatttcatgacctttcg |
226 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26496698 |
cgaagtggtgagggcgtatgaacgagttggcttattttgaagattgctagggtgagtcgtttggtatatgatcaaacgacttagatttcatgacctttcg |
26496797 |
T |
|
| Q |
227 |
ttggtagtgacgtgttcgaatccttgcgcttgttgacacgtgtctccaatcgctgttaaatctagcacaattttcgaggtgactttaaatgatgggttta |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
26496798 |
ttggtagtgacgtgttcgaatccttgcgcttgttgacacatgtctccaatcgctgttaaatccagcatgattttcgaggcgactttaaatgatgggttta |
26496897 |
T |
|
| Q |
327 |
taaagggttttgtctcttctcttcttccatttttcatttaccctttcttcgcnnnnnnngcttctggactttctccttcaactacgcgagctctcttcgg |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26496898 |
taaagggttttgtctcttctcttcttccatttttcatttaccctttcttcgctttttttgcttccggactttctccttcaacgacgcgagctctcttcgg |
26496997 |
T |
|
| Q |
427 |
tt |
428 |
Q |
| |
|
|| |
|
|
| T |
26496998 |
tt |
26496999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University