View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16939_low_7 (Length: 250)
Name: NF16939_low_7
Description: NF16939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16939_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 22029329 - 22029555
Alignment:
| Q |
18 |
ccattcagcaccatgaatggcttttgtggtgatgaatcttgcactgcatggtggtagt------tgttcattgtttgagggtttgattctaagtctttgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22029329 |
ccattcagcaccatgaatggcttttgtggtgatgaatcttgcactgcatggtggttgtggtggttgttcattgtttgagggtttgattctaagtctttgg |
22029428 |
T |
 |
| Q |
112 |
ccaaggaagatggattttttgttggggttgtagggatggagctttgtgactccaattcctttggtagcaacagtggccatatcatgaaattggttttggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22029429 |
ccaaggaagatggattttttgttggggttgtagggacggagctttgtgactccaattcctttggttgcaacagtggccatatcatgaaattggttttggt |
22029528 |
T |
 |
| Q |
212 |
ttgtgggagaaatagtttacaacttca |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22029529 |
ttgtgggagaaatagtttacaacttca |
22029555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University