View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16939_low_9 (Length: 244)
Name: NF16939_low_9
Description: NF16939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16939_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 26496478 - 26496247
Alignment:
| Q |
1 |
tgataatgtgattgtatcatagtgcaatggttgaacnnnnnnngcgtgacatgatgagacaaaatctaaacaaaattgatagtaggcgattcgccc-ata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26496478 |
tgataatgtgattgtatcatagtgcaatggttgaacaaaaaaagcgtgacatgatgagacaaaatctaaacaaaattgatagtaggcgattcgccccata |
26496379 |
T |
|
| Q |
100 |
tttcaaggatgattctagatgaaacat-taacaataatttttgactggttcatattaatctcaatcttctctcctcgaaaaatgttctcgaattccatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496378 |
tttcaaggatgattctagatgaaacatataacaataatttttaactggttcatattaatctcaatcttctctcctcgaaaaatgttctcgaattccatgt |
26496279 |
T |
|
| Q |
199 |
gtcatctttatatactttcttcattccaacgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26496278 |
gtcatctttatatactttcttcattccaacgt |
26496247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University