View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1693_high_4 (Length: 316)
Name: NF1693_high_4
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1693_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 264
Target Start/End: Complemental strand, 52271236 - 52270987
Alignment:
| Q |
15 |
gatgaaatgatgattatttttgtttttatatcaaaattgtaatgtgtaacaggagaagaacgctcaattcttttcaccggctgaagatgaaagcagcaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271236 |
gatgaaatgatgattatttttgtttttatatcaaaattgtaatgtgtaacaggagaagaacgctcaattcttttcaccggctgaagatgaaagcagcagg |
52271137 |
T |
 |
| Q |
115 |
ggagttttcaatctcataaagaaattaaatgttgttcctgataccaggataaaaggaagaactccatgtaagatctattaattttagtatttcacgaaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271136 |
ggagttttcaatctcataaagaaattaaatgttgttcctgataccaggataaaaggaagaattccatgtaagatctattaattttagtatttcacgaaat |
52271037 |
T |
 |
| Q |
215 |
tgacaaaacctatgcaatgtacaccaatcaggctttgagattatgataac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271036 |
tgacaaaacctatgcaatgtacaccaatcaggctttgagattatgataac |
52270987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 237 - 298
Target Start/End: Complemental strand, 52270988 - 52270927
Alignment:
| Q |
237 |
accaatcaggctttgagattatgataacgctaacggtttgttccattattgtatgctgcagc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52270988 |
accaatcaggctttgagattatgataacgctaacggtttgttccattattgtatgctgcagc |
52270927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University