View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1693_high_7 (Length: 215)
Name: NF1693_high_7
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1693_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 46438921 - 46438745
Alignment:
| Q |
24 |
ttagatgatggatatgtgaaagtaggtactaataaaagggttttaatatcatcatgcnnnnnnnncctttatcgattagtaaattttatgatgaccaagt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
46438921 |
ttagatgatggatatgtgaaagtaggtactaataaaagggttttaatatcatcatgcttttttttcctttatcgattagtaaattttaagatggccaagt |
46438822 |
T |
 |
| Q |
124 |
aaaatccgaaaatagattgcctaaatatattcttctgaaagaaagctnnnnnnntcatcatattcttctgaaatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46438821 |
aaaatccgaaaatagattgcctaaatatattcttctgaaagaaagctaaaaaaatcatcatattcttctgaaatata |
46438745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University