View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1693_low_11 (Length: 208)
Name: NF1693_low_11
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1693_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 15864190 - 15864369
Alignment:
| Q |
13 |
caaaggcaaaaacaacgacaccccatgtcttccaccaaaactagaatctctgtccctcgaagtagcagtagttgtccctgtaaaattagggttagaccca |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15864190 |
caaagacaaaaacaacgacaccccatgtcttccaccaaaactagaatctctgtccctcgaagtagcagtagttgtccctgtaaaattagggttagaccca |
15864289 |
T |
|
| Q |
113 |
taaagcatttgaatcccttcaatatcatcactctcaagctcaactttcttcgttcttgaacttattgtagggtacataat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15864290 |
taaagcatttgaatcccttcaatatcatcactctcaagctcaactttcttcgttcttgaacttattgtagggtacataat |
15864369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University