View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1693_low_7 (Length: 303)
Name: NF1693_low_7
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1693_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 354131 - 353996
Alignment:
| Q |
1 |
tatgaatttcacttgtctccttcccttcaaccttcaacagatcagacataaccaactgcgggtccgagtttctgagtcttttgatcaagcttctttgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
354131 |
tatgaatttcacttgtctccttcccttcaaccttcaatagatcagacataaccaactgcgggtccgagtttctgagtcttctgatcaagcttctttgtta |
354032 |
T |
 |
| Q |
101 |
tagtggcaaacttaaccttcaaaaacaaacatcaca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
354031 |
tagtggcaaacttaaccttcaaaaacaaacatcaca |
353996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University