View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1693_low_7 (Length: 303)

Name: NF1693_low_7
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1693_low_7
NF1693_low_7
[»] chr7 (1 HSPs)
chr7 (1-136)||(353996-354131)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 354131 - 353996
Alignment:
1 tatgaatttcacttgtctccttcccttcaaccttcaacagatcagacataaccaactgcgggtccgagtttctgagtcttttgatcaagcttctttgtta 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
354131 tatgaatttcacttgtctccttcccttcaaccttcaatagatcagacataaccaactgcgggtccgagtttctgagtcttctgatcaagcttctttgtta 354032  T
101 tagtggcaaacttaaccttcaaaaacaaacatcaca 136  Q
    ||||||||||||||||||||||||||||||||||||    
354031 tagtggcaaacttaaccttcaaaaacaaacatcaca 353996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University