View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16940_high_7 (Length: 254)
Name: NF16940_high_7
Description: NF16940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16940_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 8644673 - 8644722
Alignment:
| Q |
16 |
atgaatggacctttattggagctttggtaaataccttgtgtttggcttat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8644673 |
atgaatggacctttattggagctttggtaaataccttgtgtttggcttat |
8644722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 71 - 120
Target Start/End: Original strand, 8644765 - 8644814
Alignment:
| Q |
71 |
cttttacatagttgcatattgatatccactgaatggctaaatccccaacc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8644765 |
cttttacatagttgcatattgatatccagtgaatggctaaatccccaacc |
8644814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 8638476 - 8638521
Alignment:
| Q |
20 |
atggacctttattggagctttggtaaataccttgtgtttggcttat |
65 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8638476 |
atggacctttattggagctttggttaataccttttgtttggcttat |
8638521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 161
Target Start/End: Original strand, 30634789 - 30634829
Alignment:
| Q |
121 |
gaaaaatacttaattgggtacaagagtttgaacacacacac |
161 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
30634789 |
gaaaaatatttaattgggcacaagggtttgaacacacacac |
30634829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University