View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16941_high_1 (Length: 243)
Name: NF16941_high_1
Description: NF16941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16941_high_1 |
 | |
|
| [»] scaffold0076 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0076 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 38 - 225
Target Start/End: Original strand, 56882 - 57072
Alignment:
| Q |
38 |
ttttactatataccctacttttctt----aatttaactaacatgacaagttttgtcattgatattatagataatatgaggaacaagaatcacatagacac |
133 |
Q |
| |
|
||||||||||||||||||||||||| || | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56882 |
ttttactatataccctacttttcttttctaaataaaataacaagacaagttttgtcattgatattatagataatatgaggaacaagaatcacatagacac |
56981 |
T |
|
| Q |
134 |
atgtgattatctatcctctacacaatatttcacctcatcagtgctcctataaacataccataattcttagtctttaaaacaagaatcacata |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||| |||| |||||| ||||| |||||||||||||| |
|
|
| T |
56982 |
atgtgattatctatactctacacaatattttacctcatcattgctcctataaacatactataacccttagt-tttaacacaagaatcacata |
57072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University