View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_50 (Length: 298)
Name: NF16943_high_50
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 21 - 283
Target Start/End: Complemental strand, 35537632 - 35537370
Alignment:
| Q |
21 |
aaccggtggcacgatctccctccccctctctctcacatggcgccttcttctccgagcaacaccgcttcgcaactttcttcaaccgctacagaaaatgatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35537632 |
aaccggtggcacgatctccctccccctctctctcacatggcgccttcttctccgagcaacaccgcttcgcaactttcttcaaccgctacagaaaatgatc |
35537533 |
T |
|
| Q |
121 |
ttcaggttctttttccctattttactgattatcacattccattcatttctaggttttttcttaacttcaaattcttgttttatttcgaaattatttaatc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35537532 |
ttcaggttctttttccctattttactgattatcacattccattcatttctaggttttttcttaacttcaaattcttgttttatttcgaaattatttaatc |
35537433 |
T |
|
| Q |
221 |
actaattttaccaatttcttcaaatgcaatcatattatttgagcaaattagtgtctgattgat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35537432 |
actaattttaccaatttcttcaaatgcaatcatattatttgagcaaattagtgtctgattgat |
35537370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University