View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_56 (Length: 280)
Name: NF16943_high_56
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 40751480 - 40751734
Alignment:
| Q |
10 |
aagaaaatcaatgaatggaacttctttgtgatgctcaatttcgacctcatcgcgatcttgctctttctccatggaagactttaagtttgtgattaatgtt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751480 |
aagaaaatcaatgaatggaacttctttgtgatgctcaatttcgacctcatcgcgatcttgctctttctccatggaagactttaagtttgtgattaatgta |
40751579 |
T |
 |
| Q |
110 |
gatgagttatcacataaactactcaccaaatccttctttatccttccatcatcagaagaatttaaaaaaccaaaagcatttggagcaaccctcttgtaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751580 |
gatgagttatcacataaactactcaccaaatccttctttatccttccatcatcagaagaatttaaaaaaccaaaagcatttggagcaaccctcttgtaat |
40751679 |
T |
 |
| Q |
210 |
ttggaagtgatgagaatgcttgattcggacagattctgtagagaaatgatctatc |
264 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40751680 |
ttggaagtgatgagaatgcttgatttggacagattctgtagagaaatgatctatc |
40751734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University