View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_58 (Length: 264)
Name: NF16943_high_58
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 10324649 - 10324895
Alignment:
| Q |
1 |
caattgtatttgaactatgtcataagttagaatttatagaaggaggattaaggttttagggataaaaaccctaattggataattgtcttgaagacaacta |
100 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10324649 |
caattatatttgaactatgtcataaattataatttatagaaggagaattaaggttttagggacaaaaaccctaattggataattgtcttgaagacaacta |
10324748 |
T |
 |
| Q |
101 |
tagacaaaatcatgacgtgatcttcatcatgcggtcttgattctgatcaccatacttgcttatgtgtgcctctaaggcgagtgcatggtgctctccctag |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10324749 |
tagacaaaatcatgatgtgatcttcatcatgcggtcttgattttgatcaccatacttgcttatgtgtgcctctaaggcgagtgcatggtactctccctag |
10324848 |
T |
 |
| Q |
201 |
tgggttagtggccatgaaatgattcattcctttattgaattgggttt |
247 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
10324849 |
tgggttagtggccatggagtgattcattcctttattggattgggttt |
10324895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University