View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_59 (Length: 262)
Name: NF16943_high_59
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 245
Target Start/End: Complemental strand, 1391333 - 1391093
Alignment:
| Q |
6 |
ttgtcgagtgag-aagaatatgttcctcaaaattgtaaacaacggtccaaatagtctctaaattgtacaaatcggcaaatgatctctgatgcggaaggct |
104 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1391333 |
ttgtcgagtgattaagaatatgttcttcaaaattgtaaacaacggtccaaatagtctctaaattgtacaaatcggcaaatgatctctgatgtggaaggct |
1391234 |
T |
|
| Q |
105 |
atgatctgatgcgctaaacgaacatttggtcatccaggtggaatgctacatgctcaatgaacgcgccgcatcatagtatctcgaggaataaactaacagt |
204 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1391233 |
atgatctgatgcgctaaacgaacatgtggtcatccaggtggaatgctacatgctcaatgaacgcgccacatcatagtatctcgaggaataaactaacagt |
1391134 |
T |
|
| Q |
205 |
gagaccattctgactgatgtgttacattttatggatttatt |
245 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
1391133 |
gagaccattctgattgatgtgttacagtttatggatttatt |
1391093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University