View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_63 (Length: 255)
Name: NF16943_high_63
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 45247236 - 45246997
Alignment:
| Q |
1 |
aagaaacttttgccaagaaagaaggctggtgataattccattttacagcatggcaggaaacggaaggaagctcatgatactacttatgatatatcaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45247236 |
aagaaacttttgccaagaaagaaggctggtgataattccattttacagcatggcaggaaacggaaggaagctcatgatactacttatgatatatcaactt |
45247137 |
T |
|
| Q |
101 |
cacagtgtcgcaggacagggaaggcagcttatgatacttctgatttaacctctacagaagttgctgctacatcttctatgtcaaaaccaacaccagtgga |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45247136 |
cacagcgtcgcaggacagggaaggcagcttatgatacttctgatgtaacctctacagaagttgctgctacatcttctatgtcaaaaccaacaccagtgga |
45247037 |
T |
|
| Q |
201 |
gctttgctatgactcttattggactgatagatattttctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45247036 |
gctttgctatgactcttattggactgatagatattttctt |
45246997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 87 - 240
Target Start/End: Complemental strand, 45249526 - 45249373
Alignment:
| Q |
87 |
tgatatatcaacttcacagtgtcgcaggacagggaaggcagcttatgatacttctgatttaacctctacagaagttgctgctacatcttctatgtcaaaa |
186 |
Q |
| |
|
|||||||||||||||| ||| | |||||| |||||||||||||||||||||||||||| |||| | |||||||| ||||||||||||||||||||||| | |
|
|
| T |
45249526 |
tgatatatcaacttcaaagtatggcaggaaagggaaggcagcttatgatacttctgatgtaacatatacagaagctgctgctacatcttctatgtcaaca |
45249427 |
T |
|
| Q |
187 |
ccaacaccagtggagctttgctatgactcttattggactgatagatattttctt |
240 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
45249426 |
ccaaaaccagtggagctttgctatgattcttattgaactgatagatattttctt |
45249373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 146 - 231
Target Start/End: Original strand, 44865888 - 44865973
Alignment:
| Q |
146 |
taacctctacagaagttgctgctacatcttctatgtcaaaaccaacaccagtggagctttgctatgactcttattggactgataga |
231 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
44865888 |
taacctctatagaagctgctgctacatcttctatgtcaacaccgacaccaatggagctttgcaatgattcttattggactgataga |
44865973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 86 - 143
Target Start/End: Original strand, 44865510 - 44865567
Alignment:
| Q |
86 |
atgatatatcaacttcacagtgtcgcaggacagggaaggcagcttatgatacttctga |
143 |
Q |
| |
|
|||||| ||||||||||| |||| ||| || | ||||||||||||||||||||||||| |
|
|
| T |
44865510 |
atgataaatcaacttcactgtgtggcacgaaacggaaggcagcttatgatacttctga |
44865567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 146 - 231
Target Start/End: Complemental strand, 28752865 - 28752780
Alignment:
| Q |
146 |
taacctctacagaagttgctgctacatcttctatgtcaaaaccaacaccagtggagctttgctatgactcttattggactgataga |
231 |
Q |
| |
|
||||||||| ||||| |||||||||| |||||||||||| |||||||||| ||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
28752865 |
taacctctatagaagctgctgctacagcttctatgtcaacaccaacaccaatggtgctttgcaatgattcttattggactgataga |
28752780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University