View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_high_67 (Length: 245)
Name: NF16943_high_67
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_high_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 27089520 - 27089690
Alignment:
| Q |
12 |
agagaaagaggaactgggtgttaatttcagaacattgttgtttccttagagccttttctttgcaatattatactatattgtcaatgccttctgttgattg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27089520 |
agagaaagaggaactgggtgttaatttcagaacattgttgtttcctcagaaccttttctttgcaatattatactatattgtcaatgccttctgttgat-- |
27089617 |
T |
 |
| Q |
112 |
gattgttatattttgctgtagtttgcagttactactagatgtttgtgttgagtttgaatatgagagctctattca |
186 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27089618 |
--ttgttatattttgctgtagtttgcagtaactactagatgtttgtgttgagtttgaatatgagagctctattca |
27089690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University