View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16943_high_72 (Length: 231)

Name: NF16943_high_72
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16943_high_72
NF16943_high_72
[»] chr1 (1 HSPs)
chr1 (14-215)||(40408880-40409081)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 40408880 - 40409081
Alignment:
14 cataggcgcaaactcaacgataacctctagtacatgcagggagagacatgcgcaaaccctatgtctaagaggggacgtaatcgtaggggtggtttggaag 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40408880 cataggcgcaaactcaacgataacctctagtacatgcagggagaggcatgcgcaaaccctatgtctaagaggggacgtaatcgtaggggtggtttggaag 40408979  T
114 ggacttcacaaacagtgcgtcccatgttttggacccttctcaagaccagtattatgtagttattaaggagatgctgctaaggagcactaccatgaccatt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40408980 ggacttcacaaacagtgcgtcccatgttttggacccttctcaagaccagtattatgtagttattaaggagatgctgctaaggagcactaccatgaccatt 40409079  T
214 ct 215  Q
    ||    
40409080 ct 40409081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University