View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_23 (Length: 436)
Name: NF16943_low_23
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_23 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 202 - 436
Target Start/End: Original strand, 39142132 - 39142364
Alignment:
| Q |
202 |
gattttgctgcacttcaagattatgtcaaccagtgtctcaaaaggcatctttcagagcagaaatattggtcctatggaagtgaaacatcgggatcaaatg |
301 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142132 |
gattttgctgcacttgaagattatgtcaacccgtgtctcaaaaggcatctttcagagcagaaatattggtcctatggaagtgaaacatcgggatcaaatg |
39142231 |
T |
 |
| Q |
302 |
gatgaagagtgtgtgatgaaaggaacaatacttttctctccatgagatcttgatcatactggttttagttttcatggtgcaagtctatgaggatttgact |
401 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142232 |
gatgaagagtgt--gatgaaaggaacaatacttttctctccatgagatcttgatcatactggttttagttttcatggtgcaagtctatgaggatttgact |
39142329 |
T |
 |
| Q |
402 |
gtgaaaatagtccatatgttccgttttaattgcac |
436 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142330 |
gtgaaaatagtccatatgttccgttttaattgcac |
39142364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 13 - 216
Target Start/End: Original strand, 39141741 - 39141944
Alignment:
| Q |
13 |
atggtgacctaaaaatgtgtgattctggagcactttcctcctcaaacgtttttgcaataagagtctgaaacagtgattagaatcactgagattggagaac |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141741 |
atggtgacctaaaaatgtgtcattctggagcactttcctcctcaaacgtttttgcaataagagtctgaaacagtgattagaatcactgagattggagaac |
39141840 |
T |
 |
| Q |
113 |
tggtaccgtcaactcaactttcatcggtccagccattctcattttgaagcactctccttttagcattcaaaacagtgtttctacaacaggattttgctgc |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141841 |
tggaaccgtcaactcaactttcatcggtccagccattctcattttgaagcactctccttttagcattcaaaacagtgtttctacaacaggattttgctgc |
39141940 |
T |
 |
| Q |
213 |
actt |
216 |
Q |
| |
|
|||| |
|
|
| T |
39141941 |
actt |
39141944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University