View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_52 (Length: 297)
Name: NF16943_low_52
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 280
Target Start/End: Original strand, 39142537 - 39142800
Alignment:
| Q |
16 |
atggttgggttatccagtcacggcatgataacagtatttacggtgctgagcagcattggatatgttcacatgtttctgcaagctcaaatacagtatacag |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142537 |
atggttgggttatc-agtcacggcatgataacagtatttacggtgctgagcagcattggatatgttcacatgtttctgcaagctcaaatacagtatacag |
39142635 |
T |
|
| Q |
116 |
catattaatgttacctaatcaccaaagacataaatacataacttcgcaggagtgcgctcagcccccacatgattaaccttgagataattcacagcaatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39142636 |
catattaatgttacctaatcaccaaagacataaatacataacttcgcaggagtgcgctcagcccccacatgattatccttgagataattcacagcaatct |
39142735 |
T |
|
| Q |
216 |
tttaatccaaacaaacctctgtttgctgaaaatcgttggctttaccaaagaacaagcctttgaag |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142736 |
tttaatccaaacaaacctctgtttgctgaaaatcgttggctttaccaaagaacaagcctttgaag |
39142800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University