View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_56 (Length: 282)
Name: NF16943_low_56
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 27 - 229
Target Start/End: Original strand, 13411306 - 13411509
Alignment:
| Q |
27 |
gactttggatggtattattgacacaatttctgctgatcattccctcttacccctaattgatttactaaaatctcatggaaagcttgtattggttggtgcc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411306 |
gactttggatggtattattgacacaatttctgctgatcattccctcttacccctaattgatttactaaaatctcatggaaagcttgtattggttggtgcc |
13411405 |
T |
|
| Q |
127 |
ccagagaagcctcttgagttaccagcatggcctttactagtgggtaagca-tatgaaatttatattattgtagaacatgtgtatttcgtatgcttagaca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13411406 |
ccagagaagcctcttgagttaccagcatggcctttactagtgggtaagcattatgaaatttatattattgtagaacatgtgtacttcgtatgcttagaca |
13411505 |
T |
|
| Q |
226 |
ttag |
229 |
Q |
| |
|
|||| |
|
|
| T |
13411506 |
ttag |
13411509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 28 - 140
Target Start/End: Complemental strand, 13453564 - 13453452
Alignment:
| Q |
28 |
actttggatggtattattgacacaatttctgctgatcattccctcttacccctaattgatttactaaaatctcatggaaagcttgtattggttggtgccc |
127 |
Q |
| |
|
||||||||||||||||| |||||| |||| || |||||| | || ||||| || |||| |||||| || |||||||||||||||||| |||||||||| | |
|
|
| T |
13453564 |
actttggatggtattatcgacacagtttcagcggatcatccgctattacctctgattggtttactcaagtctcatggaaagcttgtaatggttggtgcac |
13453465 |
T |
|
| Q |
128 |
cagagaagcctct |
140 |
Q |
| |
|
| || |||||||| |
|
|
| T |
13453464 |
ctgaaaagcctct |
13453452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 13412811 - 13412762
Alignment:
| Q |
28 |
actttggatggtattattgacacaatttctgctgatcattccctcttacc |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||| | |||||||| |
|
|
| T |
13412811 |
actttggatggtattattgacacagtttcagctgttcatcctctcttacc |
13412762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 124
Target Start/End: Original strand, 13389590 - 13389686
Alignment:
| Q |
28 |
actttggatggtattattgacacaatttctgctgatcattccctcttacccctaattgatttactaaaatctcatggaaagcttgtattggttggtg |
124 |
Q |
| |
|
|||||||||||||| || || ||| |||| || ||||| | ||||||||||||||| ||| | || ||||||||||| |||||| ||||||||| |
|
|
| T |
13389590 |
actttggatggtatcatcgatacagtttcagcaaatcatcctatcttacccctaattggattattgaagtctcatggaaaacttgtaatggttggtg |
13389686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 28 - 140
Target Start/End: Complemental strand, 47600979 - 47600867
Alignment:
| Q |
28 |
actttggatggtattattgacacaatttctgctgatcattccctcttacccctaattgatttactaaaatctcatggaaagcttgtattggttggtgccc |
127 |
Q |
| |
|
|||||||||||||| ||||||||| |||| ||||| ||| | |||| ||| ||||||| ||||| || ||||||||||| |||||| |||||||||| | |
|
|
| T |
47600979 |
actttggatggtatcattgacacagtttcagctgaacatcctctctcacctctaattggattactgaagtctcatggaaaacttgtaatggttggtgctc |
47600880 |
T |
|
| Q |
128 |
cagagaagcctct |
140 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
47600879 |
cagcgaagcctct |
47600867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 94 - 175
Target Start/End: Original strand, 28431231 - 28431312
Alignment:
| Q |
94 |
aaatctcatggaaagcttgtattggttggtgccccagagaagcctcttgagttaccagcatggcctttactagtgggtaagc |
175 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| || ||||||||||| ||| |||||| || |||||||| ||||||||| |
|
|
| T |
28431231 |
aaatctcatggaaaacttgttatggttggtgcacctgagaagcctctggagctaccagtatttcctttacttatgggtaagc |
28431312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University