View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_65 (Length: 255)
Name: NF16943_low_65
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 59 - 238
Target Start/End: Complemental strand, 22554336 - 22554157
Alignment:
| Q |
59 |
tagtagcaagttacatttgtcacgtaacgtgtgatgatctaagataaggtaaagggataagaaaatctgaaagaaatgtgaaagtaaacataaactgcaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22554336 |
tagtagcaagttacatttgtcacgtaacgtgtgatgatctaagataaggtaaagggataagaaaatctgaaagaaatgtgaaagtaaacataaactgcaa |
22554237 |
T |
 |
| Q |
159 |
caaaaaccctactttagtgctacaccaacatcagaagcaacaaccataatcagaaacaacaataaaaacatgctatttat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22554236 |
caaaaaccctactttagtgctacaccaacatgagaagcaacaaccataatcagaaacaacaataaaaacatgctatttat |
22554157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University