View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_72 (Length: 244)
Name: NF16943_low_72
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 29333820 - 29334040
Alignment:
| Q |
1 |
ttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttccacgtcagcttttctgttgaattttagaagaaagacagtggcagtattgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29333820 |
ttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttccacgtcagcttttctgttgaattttagaagaaagacagtggcagtattgta |
29333919 |
T |
|
| Q |
101 |
atttgtgaagaagggtttttctcttattatatagggttaatgggggttaatgtagtggcagtaaaaacccgttactcagttctgtctggtcaaagttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
29333920 |
atttgtgaagaagggtttttctcttattatata----------gggttaatgtagtggcagtaaaaacccgt---tcagttctgtctagtcaaagttgtt |
29334006 |
T |
|
| Q |
201 |
atttgcgactagttacttgagctcttcatatcac |
234 |
Q |
| |
|
||||||| | |||||||||||||||| |||||| |
|
|
| T |
29334007 |
atttgcgggtggttacttgagctcttcttatcac |
29334040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University