View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16943_low_82 (Length: 212)
Name: NF16943_low_82
Description: NF16943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16943_low_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 37718023 - 37718206
Alignment:
| Q |
19 |
ctaagtttgtggaccagtaactttgtgatgcatctgctactaccatatttccatcctttgcgatttgaaaaactcctttagaatctacaatagggttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37718023 |
ctaagtttgtggaccagtaactttgtgatgcatctgctactaccatatttccatcctttgcgatttgaaaaactcctttagaatctacaatagggttgtt |
37718122 |
T |
 |
| Q |
119 |
tctgttggctacccaaaccactgtttgtggttccagatcgtgataccatattcccaagtattttttaagattctctgtgctgct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
37718123 |
tctgttggctacccaaaccactgtttgtggttccagatcgtgataccatattcccaagtattttttaagattctcggtgttgct |
37718206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University