View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16944_high_10 (Length: 292)
Name: NF16944_high_10
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16944_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 36570838 - 36570881
Alignment:
| Q |
19 |
cttcagatctgcattgataaaccctttatttctgtaattttgaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36570838 |
cttcagatctgcattgataaaccctttatttctggaattttgaa |
36570881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 39233688 - 39233737
Alignment:
| Q |
167 |
atgttatggaaaaattatttcaagatttttgtgtatttactatgtagcta |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
39233688 |
atgttatggaaaaattgtttcaagatttttgtgtatttatcatgtagcta |
39233737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 52603771 - 52603725
Alignment:
| Q |
19 |
cttcagatctgcattgataaaccctttatttctgtaattttgaatct |
65 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| |||||||||||| |
|
|
| T |
52603771 |
cttcagatctacattgataaaacctttatttctggaattttgaatct |
52603725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University