View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16944_low_14 (Length: 283)
Name: NF16944_low_14
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16944_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 269
Target Start/End: Complemental strand, 26954427 - 26954173
Alignment:
| Q |
14 |
gaactagccgagaagagtgtgtggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctca |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954427 |
gaactagcagagaagagtgtgtggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctca |
26954328 |
T |
 |
| Q |
114 |
tagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtatccaacaaaaaacaacagttagttgtatacttctaaattgcaattt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26954327 |
tagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtatccaacaaaaaac-acagttagttgtatacttctaaattgcaattt |
26954229 |
T |
 |
| Q |
214 |
atgcaggtctatctcggacacaatactgaaatatgtggctatattcgactacttat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954228 |
atgcaggtctatctcggacacaatactgaaatatgtggctatattcgactacttat |
26954173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 168
Target Start/End: Original strand, 26975976 - 26976109
Alignment:
| Q |
35 |
tggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctcatagatactgctgttgttggtc |
134 |
Q |
| |
|
|||| ||| |||||||||||||| |||||| ||||| ||||| || | |||||||||| || | ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
26975976 |
tggattcagatgaaggaaattgtattgtttactggacctgctattggtctttggttatgtggaccgttgatgagtctcattgataccgctgttgttggtc |
26976075 |
T |
 |
| Q |
135 |
agggaagttcaaccgagcttgctgctttaggtat |
168 |
Q |
| |
|
| |||||||||| || ||||||||||||||||| |
|
|
| T |
26976076 |
aaggaagttcaattgaacttgctgctttaggtat |
26976109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 168
Target Start/End: Complemental strand, 27005930 - 27005797
Alignment:
| Q |
35 |
tggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctcatagatactgctgttgttggtc |
134 |
Q |
| |
|
|||| ||| |||||||||||||| |||||| ||||| ||||| || | |||||||||| || | ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
27005930 |
tggattcagatgaaggaaattgtattgtttactggacctgctattggtctttggttatgtggaccgttgatgagtctcattgatacagctgttgttggtc |
27005831 |
T |
 |
| Q |
135 |
agggaagttcaaccgagcttgctgctttaggtat |
168 |
Q |
| |
|
| |||||||||| || ||||||||||||||||| |
|
|
| T |
27005830 |
aaggaagttcaattgaacttgctgctttaggtat |
27005797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 26946526 - 26946474
Alignment:
| Q |
116 |
gatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtat |
168 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26946526 |
gatactgctgttattggtcagggaagttcaattgagcttgctgctttaggtat |
26946474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 168
Target Start/End: Complemental strand, 26991415 - 26991351
Alignment:
| Q |
104 |
atgagcctcatagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtat |
168 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||| | || ||||||||||||||||| |
|
|
| T |
26991415 |
atgagtctcattgatactgctgttgttggtcaaggaagttcgattgaacttgctgctttaggtat |
26991351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University