View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16944_low_17 (Length: 238)
Name: NF16944_low_17
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16944_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 56040 - 56259
Alignment:
| Q |
1 |
ttcgtctatccacgaaacccaactaaaggcatctcgcgacgtaaggtgccaactaacnnnnnnnnggtttggcagtcaggtcatccattgatcatatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56040 |
ttcgtctatccacgaaacccaactaaaggcatctcgcgacgtaaggtgccaactaacttttttttggtttggcagtcaggtcatgcattgatcatatata |
56139 |
T |
|
| Q |
101 |
gaaatgatggatttctctatctgtctgtaacaaacaggtggcaatggcaactgctgcaaaagcaaagttacttctccgagagcttaagacggtgaaagca |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56140 |
gaactgatggatttctctatctgtctgtaacaaacaggtggcaatggcaactgctgcaaaagcaaagttacttctccgagagcttaagacggtgaaagca |
56239 |
T |
|
| Q |
201 |
gatttagctttcgctaaagc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
56240 |
gatttagctttcgctaaagc |
56259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 220
Target Start/End: Complemental strand, 27700549 - 27700464
Alignment:
| Q |
135 |
caggtggcaatggcaactgctgcaaaagcaaagttacttctccgagagcttaagacggtgaaagcagatttagctttcgctaaagc |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| || ||| | || ||||| ||||| |||||||| || |||||||| |
|
|
| T |
27700549 |
caggtggcaatggcaacagctgcaaaagcaaagttacttcttcgtgagttaaaaacggttaaagcggatttagcatttgctaaagc |
27700464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 27701066 - 27701026
Alignment:
| Q |
14 |
gaaacccaactaaaggcatctcgcgacgtaaggtgccaact |
54 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27701066 |
gaaacgcaactcaaggcatctcgcgacgtaaggtgccaact |
27701026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University