View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16944_low_20 (Length: 217)
Name: NF16944_low_20
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16944_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 178
Target Start/End: Complemental strand, 30810489 - 30810328
Alignment:
| Q |
17 |
cacagatctatgcaatcgtcgacgatgatctcagagggaaaagggggatgaaaaattgaaaataaatgtttatgaaacaagggggagaagaattgtgtga |
116 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810489 |
cacatatctatgaaatcgtcgacgatgatctgagagggaaaagggggatgagaaattgaaaataaatgtttatgaaacaagggggagaagaattgtgtga |
30810390 |
T |
 |
| Q |
117 |
tgtgaggatgacatcgagagatatggagagaagaaaaagcataatcaaagatgtaaatttga |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30810389 |
tgtgaggatgacatcgagagatatggagagaagaaaaagcagaatcaaagatgtaaatttga |
30810328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University