View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16944_low_8 (Length: 392)
Name: NF16944_low_8
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16944_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 51769396 - 51769656
Alignment:
| Q |
11 |
caaaggtataatcaaatctattggccacaatattctgaaaatgatcaatatgatgcataagtgaaacatatcttacattatacataggtttgtttctgct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||| |||||| |||| | ||| |
|
|
| T |
51769396 |
caaaggtataatcaaatctattggccacaatattctgaacatgatcaatatgatgcataagcgaaacaaatcttacattatagataggtctgttcc-gct |
51769494 |
T |
 |
| Q |
111 |
aatggatcaaaaagtcttaccatcggatcaaatgtgatatgatatgaagtttagcaattaggtttgttaccaatgcaagatttatttacttgtgtaaatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51769495 |
aatggatcaaaaagtcttaccatcggatcaaatgtgatatgatatgaagtttagcaattaggtttgttaccaatgcaatatttatttacttgtgtaaatt |
51769594 |
T |
 |
| Q |
211 |
ggtcaaaacctccaagttataaagtttattgtggaaaactggaaatatctcattccttgcct |
272 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51769595 |
ggtcaaaatctccaagttataaagtttattgtggaaaattggaaatatctcattccttgcct |
51769656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 51769722 - 51769776
Alignment:
| Q |
338 |
tttgtgggtcaaaatgacagatttaagaagacgagacaaactgcatatgtttaac |
392 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51769722 |
tttgtgggtcaaaatgacagagttaagaagacgagacaaactgcatatgtttaac |
51769776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University