View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16945_high_1 (Length: 215)
Name: NF16945_high_1
Description: NF16945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16945_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 53095824 - 53095620
Alignment:
| Q |
1 |
ttcctgctgcaggaccacaggtttaaatctttctcactatggactcctatgatgttatattaatgaactacaaattttaggtgccatcttttacaaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53095824 |
ttcctgctgcaggaccacaggtttaaatctttctcactatagactcctatgatgttatattaatgaactacaaattttaggtgccatcttttacaaagac |
53095725 |
T |
 |
| Q |
101 |
agcttatagtgatttatattattgttcaaacatgaatgtggcaggtaaagtttattgtttagaataacctgccccaccaagaaaaagggacaatgtgcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53095724 |
agcttatagtgatttatattattgttcaaacatgaatgtggcaggtaaagtttattgtttagaataacctgccccaccaagaaaaagggacaatgtgcag |
53095625 |
T |
 |
| Q |
201 |
ttcat |
205 |
Q |
| |
|
||||| |
|
|
| T |
53095624 |
ttcat |
53095620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University