View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16945_low_1 (Length: 336)
Name: NF16945_low_1
Description: NF16945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16945_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 3 - 320
Target Start/End: Complemental strand, 9497152 - 9496823
Alignment:
| Q |
3 |
cgagagagatgaggcatttggtctcttctaggaa----gtcgagttcttttgagatgttttcgatgtcttgaaagggatgtgtgg-----ctctctagct |
93 |
Q |
| |
|
|||||| | ||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9497152 |
cgagagtggtgaagcatttggtcgcttctaggaattaagtcgagttcttttgagatgttttcgatgtcttgaaagggatgtgtggtgtggctctctagct |
9497053 |
T |
|
| Q |
94 |
cagcttccatttcttgattggaatcactacttcagagccata----agtgagtctgaatgggggtttctcttgtagtagaatgcaaagtagctccacatc |
189 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9497052 |
cagcttccatttcttgattaggatcactactt-agagccatatataagtgagtctgaatgggggtttcttttgtagtagaatgcaaagtagctccacatc |
9496954 |
T |
|
| Q |
190 |
gagatatcatctgcacaacacctcagtttaggcaaaatagaatgctcattaagcatgtgccagcaatcagttagcatgactctgaagcgaagttcatgac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
9496953 |
gagatatcatctgcacaacacctcagtttaggtaaaatagaatgctcagtaagcatgtgccagcaatcagttaccatgcctctgaagcgaagttcatgat |
9496854 |
T |
|
| Q |
290 |
tccatgcattctcataacgacaaataacttc |
320 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
9496853 |
tccatgcattctcataacgacaaacaacttc |
9496823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University