View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16946_low_2 (Length: 233)
Name: NF16946_low_2
Description: NF16946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16946_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 151
Target Start/End: Complemental strand, 7797930 - 7797796
Alignment:
| Q |
17 |
aatatttagacaaattcactgattcaaagtatatgtaagttgagagatcatggaatagattttgacaaattcaacgattcatagtatcatttatgtacgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7797930 |
aatatttagacaaattcactgattcaaagtatatgtaagttgagagatcatggaatagattttgacaaattcaacgattcatagtatcatttatgtacgt |
7797831 |
T |
|
| Q |
117 |
aactgtaaagattaatttcatcgtatatgtgtgtg |
151 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |
|
|
| T |
7797830 |
aactataaagattaatttcattgtatatgtgtgtg |
7797796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 151
Target Start/End: Complemental strand, 7817200 - 7817066
Alignment:
| Q |
17 |
aatatttagacaaattcactgattcaaagtatatgtaagttgagagatcatggaatagattttgacaaattcaacgattcatagtatcatttatgtacgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7817200 |
aatatttagacaaattcactgattcaaagtatatgtaagttgagagatcatggaatagattttgacaaattcaacgattcatagtatcatttatgtacgt |
7817101 |
T |
|
| Q |
117 |
aactgtaaagattaatttcatcgtatatgtgtgtg |
151 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |
|
|
| T |
7817100 |
aactataaagattaatttcattgtatatgtgtgtg |
7817066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University