View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16948_high_28 (Length: 212)
Name: NF16948_high_28
Description: NF16948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16948_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 193
Target Start/End: Complemental strand, 33010343 - 33010169
Alignment:
| Q |
20 |
tcccggtgatcttatttttcaactagtcctgaaaccacgtttactactacttgtataacatgaaaaattatgtagagttgttgatttttcatgtat-ttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
33010343 |
tcccggtgatcttatttttcaactagccctgaaaccacgtttactactacttgtataacatgaaaaattatgcagagttgttgatttttcatgtatgttt |
33010244 |
T |
 |
| Q |
119 |
tctgaattttctcacgttttctcgatgtttctgagatggaaagacatgttgatgcgtttgggaggataaagtctc |
193 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010243 |
tttgaattttctcacgttttctcgatgtttctgagatggaaagacatgttgatgcgtttgggaggataaagtctc |
33010169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University