View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16948_high_29 (Length: 208)

Name: NF16948_high_29
Description: NF16948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16948_high_29
NF16948_high_29
[»] chr3 (1 HSPs)
chr3 (19-195)||(45894170-45894344)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 45894344 - 45894170
Alignment:
19 tttgcaactaattaacatatttgccagattttttccctttaaaaccacacgaatatctttccacttttagaaaataatgctttacatggcataaccataa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45894344 tttgcaactaattaacatatttgccagattttttccctttaaaaccacacgaatatctttccacttttagaaaataatgctttacatggcataaccataa 45894245  T
119 taactatatgaatcagttatttccaaatttccattgccactctctctatatatctctttctttctgttacactctct 195  Q
    ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45894244 taac--tatgaatcagttatttccaaatttccattgccactctctctatatatctctttctttctgttacactctct 45894170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University