View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16948_low_13 (Length: 418)
Name: NF16948_low_13
Description: NF16948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16948_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 200 - 337
Target Start/End: Original strand, 10071977 - 10072106
Alignment:
| Q |
200 |
agaaacaacaatgttctagttcttgtttggcatggtactaagcaagaatgcaagattttggttcttgtcaagttgcagaagcatttttgttgggctctag |
299 |
Q |
| |
|
|||| ||||||||| ||||||||||| | |||||||||||||||||| | |||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10071977 |
agaatcaacaatgtgctagttcttgtctagcatggtactaagcaaga--------tgttggttcttgtcaagttgcagaagcattgttgttggactctag |
10072068 |
T |
|
| Q |
300 |
cacggttggctcgttgtaatagttcaaatgatgaaatt |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10072069 |
cacggttggctcattgtaatagttcaaatgatgtaatt |
10072106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 145 - 206
Target Start/End: Original strand, 10071890 - 10071951
Alignment:
| Q |
145 |
cattatgtgtgtgtggcaatcatcctctctttctttagctaaaaagaaaattaaaagaaaca |
206 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10071890 |
cattatgtgtgggtagcaatcatcctctctttctttagctaaaaagaaaattaaaagaaaca |
10071951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 337
Target Start/End: Original strand, 10079392 - 10079470
Alignment:
| Q |
260 |
gttcttgtcaagttgcagaagcattttt-gttgggctctagcacggttggctcgttgtaatagttcaaatgatgaaatt |
337 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||| |||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10079392 |
gttctcgtcaagttgttgaagcattttttgttcaactctcgcgcggttggctcgttgttatagttcaaatgatgaaatt |
10079470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 260 - 337
Target Start/End: Original strand, 10096045 - 10096123
Alignment:
| Q |
260 |
gttcttgtcaagttgcagaagcattttt-gttgggctctagcacggttggctcgttgtaatagttcaaatgatgaaatt |
337 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| || | |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
10096045 |
gttcttgtcaagttgttgaagcattttttgttcaactttcgcacaattggctcgttgttatagttcaaatgatgaaatt |
10096123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 358 - 410
Target Start/End: Original strand, 10103693 - 10103745
Alignment:
| Q |
358 |
gacaaaattcatcgctttgaagtaatagtatctatacaaaattaattcttctc |
410 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||| |||||||| |||| |
|
|
| T |
10103693 |
gacaaatttcatcgctttgaactaatataatctatacaatattaattcatctc |
10103745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University