View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16948_low_30 (Length: 208)
Name: NF16948_low_30
Description: NF16948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16948_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 45894344 - 45894170
Alignment:
| Q |
19 |
tttgcaactaattaacatatttgccagattttttccctttaaaaccacacgaatatctttccacttttagaaaataatgctttacatggcataaccataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45894344 |
tttgcaactaattaacatatttgccagattttttccctttaaaaccacacgaatatctttccacttttagaaaataatgctttacatggcataaccataa |
45894245 |
T |
 |
| Q |
119 |
taactatatgaatcagttatttccaaatttccattgccactctctctatatatctctttctttctgttacactctct |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45894244 |
taac--tatgaatcagttatttccaaatttccattgccactctctctatatatctctttctttctgttacactctct |
45894170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University