View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1694_high_4 (Length: 260)

Name: NF1694_high_4
Description: NF1694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1694_high_4
NF1694_high_4
[»] chr2 (1 HSPs)
chr2 (18-252)||(3945448-3945682)


Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 3945682 - 3945448
Alignment:
18 actcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatactattggatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3945682 actcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatactattggatt 3945583  T
118 aggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttcttcttct 217  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3945582 aggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttcttcttct 3945483  T
218 gtaccaagtaatgcatcagttatgccctctctgct 252  Q
    |||||||||||||||||||||||||| ||||||||    
3945482 gtaccaagtaatgcatcagttatgccttctctgct 3945448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University